Stem-loop sequence mmu-mir-721

Accession MI0004708
Symbol MGI:Mir721
Description Mus musculus miR-721 stem-loop
Stem-loop
   ------ggaagaca u     uaaa   gg   aa    ac  g  a 
5'               g gcaau    agg  gaa  aagu  cu gg u
                 | |||||    |||  |||  ||||  || || g
3'               c cguua    uuc  uuu  uuua  ga uc u
   aagguucguccuca -     -uug   uu   ac    -a  g  u 
Get sequence
Deep sequencing
13 reads, 0.722 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr5: 136375716-136375803 [-]
sense
OTTMUST00000104308 ; Cux1-003; intron 3
OTTMUST00000104300 ; Cux1-004; intron 4
OTTMUST00000104301 ; Cux1-006; intron 4
OTTMUST00000104302 ; Cux1-009; intron 4
OTTMUST00000104304 ; Cux1-001; intron 4
OTTMUST00000104344 ; Cux1-018; intron 4
OTTMUST00000104305 ; Cux1-005; intron 4
OTTMUST00000104306 ; Cux1-011; intron 4
OTTMUST00000104309 ; Cux1-007; intron 4
ENSMUST00000175918 ; Cux1-003; intron 3
ENSMUST00000176216 ; Cux1-004; intron 4
ENSMUST00000176745 ; Cux1-006; intron 4
ENSMUST00000177297 ; Cux1-009; intron 4
ENSMUST00000004097 ; Cux1-001; intron 4
ENSMUST00000175975 ; Cux1-018; intron 4
ENSMUST00000176778 ; Cux1-005; intron 4
ENSMUST00000176172 ; Cux1-011; intron 4
ENSMUST00000176501 ; Cux1-007; intron 4
antisense
OTTMUST00000104311 ; RP23-311J12.2-001; intron 1
ENSMUST00000148082 ; Gm16599-001; intron 1
Database links

Mature sequence mmu-miR-721

Accession MIMAT0003515
Sequence

7 - 

cagugcaauuaaaagggggaa

 - 27

Get sequence
Evidence experimental; cloned [1], insitu [1], Northern [1]
Validated targets
Predicted targets

References

1
PMID:16566924 "Identification of new central nervous system specific mouse microRNAs" Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T FEBS Lett. 580:2195-2200(2006).