Stem-loop sequence mmu-mir-718

AccessionMI0004707 (change log)
Symbol MGI:Mir718
DescriptionMus musculus miR-718 stem-loop
Gene family MIPF0000721; mir-718
Literature search

5 open access papers mention mmu-mir-718
(7 sentences)

Stem-loop
   ac   cc         gaa     c  ag  c    u       gg 
5'   gcc  cguguggcg   ggccg gg  gg aaga ggcggcg  u
     |||  |||||||||   ||||| ||  || |||| |||||||  c
3'   cgg  gcacgcugu   ccggc cc  cc uucu ccgccgc  g
   --   -a         ggg     -  -g  -    -       ga 
Get sequence
Deep sequencing
37 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 74023849-74023936 [-]
sense
OTTMUST00000042885 ; Irak1-001; 5'UTR (exon 1)
OTTMUST00000043842 ; Irak1-004; 5'UTR (exon 1)
OTTMUST00000045161 ; Irak1-005; 5'UTR (exon 1)
OTTMUST00000045162 ; Irak1-006; 5'UTR (exon 1)
OTTMUST00000043841 ; Irak1-003; 5'UTR (exon 1)
ENSMUST00000114354 ; Irak1-001; 5'UTR (exon 1)
ENSMUST00000114352 ; Irak1-004; 5'UTR (exon 1)
ENSMUST00000068286 ; Irak1-005; 5'UTR (exon 1)
ENSMUST00000114360 ; Irak1-006; 5'UTR (exon 1)
ENSMUST00000033769 ; Irak1-003; 5'UTR (exon 1)
Clustered miRNAs
< 10kb from mmu-mir-718
mmu-mir-718chrX: 74023849-74023936 [-]
mmu-mir-5132chrX: 74023528-74023598 [-]
Database links

Mature sequence mmu-miR-718

Accession MIMAT0003514
Sequence

60 - 

cuuccgcccggccgggugucg

 - 80

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).