Stem-loop sequence mmu-mir-450b

AccessionMI0004705 (change log)
Symbol MGI:Mir450b
DescriptionMus musculus miR-450b stem-loop
Gene family MIPF0000128; mir-450
Literature search

7 open access papers mention mmu-mir-450b
(16 sentences)

Stem-loop
                uuu     u        g     auaa 
5' gauacagaauuau   ugcag auguuccu aauac    c
   |||||||||||||   ||||| |||||||| |||||    a
3' cuauguuuuaaua   acguu uacaaggg uuaug    u
                cgu     u        -     cgaa 
Get sequence
Deep sequencing
25240 reads, 27.6 reads per million, 105 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 53047997-53048078 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-450b
mmu-mir-322chrX: 53054255-53054349 [-]
mmu-mir-503chrX: 53053984-53054054 [-]
mmu-mir-351chrX: 53053255-53053353 [-]
mmu-mir-542chrX: 53049403-53049487 [-]
mmu-mir-450a-2chrX: 53048299-53048367 [-]
mmu-mir-450a-1chrX: 53048154-53048244 [-]
mmu-mir-450bchrX: 53047997-53048078 [-]
Database links

Mature sequence mmu-miR-450b-5p

Accession MIMAT0003511
Previous IDsmmu-miR-450b
Sequence

14 - 

uuuugcaguauguuccugaaua

 - 35

Get sequence
Deep sequencing18730 reads, 95 experiments
Evidence experimental; MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-450b-3p

Accession MIMAT0003512
Previous IDsmmu-miR-450b*
Sequence

50 - 

auugggaacauuuugcaugcau

 - 71

Get sequence
Deep sequencing6508 reads, 99 experiments
Evidence experimental; MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).