Stem-loop sequence mmu-mir-717

AccessionMI0004704 (change log)
Symbol MGI:Mir717
DescriptionMus musculus miR-717 stem-loop
Literature search

3 open access papers mention mmu-mir-717
(16 sentences)

Stem-loop
   uuguccgcuauca   -uacc         c      ----a   a    -  c     c  a 
5'              cug     gucauuuuu agucuc     gac gaga ua cuucu ug a
                |||     ||||||||| ||||||     ||| |||| || ||||| ||  
3'              gac     uagugaaga uuaggg     uug cucu gu gaaga ac u
   -------------   cuaaa         c      aagcc   c    c  c     u  u 
Get sequence
Deep sequencing
26 reads, 12.5 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 52422407-52422515 [-]
sense
OTTMUST00000042115 ; Gpc3-001; intron 3
OTTMUST00000042708 ; Gpc3-002; intron 3
ENSMUST00000069360 ; Gpc3-001; intron 3
ENSMUST00000114857 ; Gpc3-002; intron 3
Database links

Mature sequence mmu-miR-717

Accession MIMAT0003510
Sequence

34 - 

cucagacagagauaccuucucu

 - 55

Get sequence
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).