Stem-loop sequence mmu-mir-714

AccessionMI0004699 (change log)
Symbol MGI:Mir714
DescriptionMus musculus miR-714 stem-loop
Literature search

9 open access papers mention mmu-mir-714
(25 sentences)

Stem-loop
     a  -a    c gu  -    -       -       u  g   g g   g   c 
5' cg cg  gggc g  cg gucg cccugcg gugguug cu ugu u uuu ggu u
   || ||  |||| |  || |||| ||||||| ||||||| || ||| | ||| ||| u
3' gc gc  cccg c  gc cggu ggggcgc cgccagc gg gcg a ggg ucg g
     c  gg    - ug  g    u       u       u  g   g g   g   c 
Get sequence
Deep sequencing
1085 reads, 0 reads per million, 81 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mmu-miR-714

Accession MIMAT0003505
Sequence

1 - 

cgacgagggccggucggucgc

 - 21

Get sequence
Deep sequencing167 reads, 41 experiments
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).