Stem-loop sequence mmu-mir-712

AccessionMI0004696 (change log)
Symbol MGI:Mir712
DescriptionMus musculus miR-712 stem-loop
Literature search

13 open access papers mention mmu-mir-712
(43 sentences)

Stem-loop
         cuu   - uu        c   -  c   uc      -   - -      g 
5' ucuccg   cuc c  cacccggg ggu ac cgc  cggcgc cgg c ccgcgg a
   ||||||   ||| |  |||||||| ||| || |||  |||||| ||| | ||||||  
3' aggggc   gag g  gugggccc cca ug gcg  gccgcg gcc g ggcgcc c
         -uu   c uu        -   c  a   ua      u   u c      g 
Get sequence
Deep sequencing
1320 reads, 0 reads per million, 93 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

mir-712a and mir-712b sequences [1] map to the same genomic locus in mouse genome assembly NCBI36. The reported miR-712b mature sequence is two bases longer at the 3' end (UCCUUCACCCGGGCGGUACCCG) than that shown here.

Database links

Mature sequence mmu-miR-712-5p

Accession MIMAT0003502
Previous IDsmmu-miR-712
Sequence

10 - 

cuccuucacccgggcgguacc

 - 30

Get sequence
Deep sequencing149 reads, 47 experiments
Evidence experimental; MPSS [1]
Database links
Predicted targets

Mature sequence mmu-miR-712-3p

Accession MIMAT0003743
Previous IDsmmu-miR-712*
Sequence

76 - 

ugcgagucacccccggguguug

 - 97

Get sequence
Deep sequencing209 reads, 48 experiments
Evidence experimental; MPSS [1]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).