Stem-loop sequence mmu-mir-711

AccessionMI0004695 (change log)
Symbol MGI:Mir711
DescriptionMus musculus miR-711 stem-loop
Gene family MIPF0000748; mir-711
Literature search

14 open access papers mention mmu-mir-711
(160 sentences)

Stem-loop
      g      -    uga          a    g      gc 
5' cau uuccua acuu   aucucuucuu gggu cuucag  a
   ||| |||||| ||||   |||||||||| |||| ||||||   
3' gua aggggu ugaa   uagagagggg ccca gggguc  a
      g      c    -ug          -    -      ga 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 108969922-108970003 [+]
sense
OTTMUST00000050582 ; Col7a1-002; intron 1
OTTMUST00000050581 ; Col7a1-001; intron 62
ENSMUST00000126780 ; Col7a1-002; intron 1
ENSMUST00000026740 ; Col7a1-201; intron 61
ENSMUST00000112070 ; Col7a1-001; intron 62
Database links

Mature sequence mmu-miR-711

Accession MIMAT0003501
Sequence

49 - 

gggacccggggagagauguaag

 - 70

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).