Stem-loop sequence mmu-mir-710

AccessionMI0004694 (change log)
Symbol MGI:Mir710
DescriptionMus musculus miR-710 stem-loop
Literature search

3 open access papers mention mmu-mir-710
(11 sentences)

Stem-loop
       c  ---g   -aa    a   -    -  ugg           cuu      aaa 
5' cucu uc    uca   uaga gcc aagu cu   ggagaguugag   ggugug   a
   |||| ||    |||   |||| ||| |||| ||   |||||||||||   ||||||    
3' gagg ag    ggu   gucu ugg uuca ga   uuucucaacuu   ccauac   c
       u  guga   gaa    a   a    a  ---           -cc      agu 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 64514332-64514441 [-]
intergenic
Database links

Mature sequence mmu-miR-710

Accession MIMAT0003500
Sequence

20 - 

ccaagucuuggggagaguugag

 - 41

Get sequence
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).