Stem-loop sequence mmu-mir-708

AccessionMI0004692 (change log)
Symbol MGI:Mir708
DescriptionMus musculus miR-708 stem-loop
Gene family MIPF0000397; mir-708
Literature search

28 open access papers mention mmu-mir-708
(210 sentences)

Stem-loop
   cuguguuugaaa     --a        a           a     c  g gg   a  a 
5'             ugggg   cugcccuc aggagcuuaca ucuag ug g  uag ug c
               |||||   |||||||| ||||||||||| ||||| || |  ||| || u
3'             auucc   gacgggag ucuucgagugu agauc ac c  guu ac u
   ------------     ggg        a           c     a  a aa   c  g 
Get sequence
Deep sequencing
90505 reads, 374 reads per million, 94 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 96249424-96249532 [+]
sense
OTTMUST00000050320 ; Odz4-001; intron 1
OTTMUST00000050321 ; Odz4-002; intron 1
OTTMUST00000050322 ; Odz4-003; intron 1
OTTMUST00000050323 ; Odz4-004; intron 1
OTTMUST00000050347 ; Odz4-009; intron 1
OTTMUST00000050348 ; Odz4-010; intron 1
OTTMUST00000050349 ; Odz4-011; intron 1
ENSMUST00000107162 ; Tenm4-001; intron 1
ENSMUST00000144263 ; Tenm4-003; intron 1
ENSMUST00000133770 ; Tenm4-011; intron 1
ENSMUST00000129445 ; Tenm4-002; intron 1
ENSMUST00000138760 ; Tenm4-004; intron 1
ENSMUST00000107166 ; Tenm4-009; intron 1
ENSMUST00000107165 ; Tenm4-010; intron 1
Database links

Mature sequence mmu-miR-708-5p

Accession MIMAT0004828
Previous IDsmmu-miR-708
Sequence

27 - 

aaggagcuuacaaucuagcuggg

 - 49

Get sequence
Deep sequencing67027 reads, 88 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-708-3p

Accession MIMAT0003498
Previous IDsmmu-miR-708;mmu-miR-708*
Sequence

73 - 

caacuagacugugagcuucuag

 - 94

Get sequence
Deep sequencing22139 reads, 71 experiments
Evidence experimental; MPSS [1], miRAP-cloned [2], cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).