Stem-loop sequence mmu-mir-707

AccessionMI0004691 (change log)
Symbol MGI:Mir707
DescriptionMus musculus miR-707 stem-loop
Literature search

3 open access papers mention mmu-mir-707
(3 sentences)

Stem-loop
   ---------g   u    uc   -    u      c    g 
5'           gca gcag  aug ccgc ugccua gcuu u
             ||| ||||  ||| |||| |||||| ||||  
3'           cgu uguu  uac ggcg acgggu cgag g
   gcuuaacggg   -    ga   u    u      a    u 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 44849699-44849771 [+]
sense
OTTMUST00000055803 ; Akt1s1-004; intron 1
OTTMUST00000055801 ; Akt1s1-002; exon 1
OTTMUST00000055804 ; Akt1s1-005; intron 1
OTTMUST00000055802 ; Akt1s1-003; 3'UTR (exon 1)
ENSMUST00000107885 ; Akt1s1-004; intron 1
ENSMUST00000152091 ; Akt1s1-002; exon 1
ENSMUST00000150335 ; Akt1s1-005; intron 1
ENSMUST00000107882 ; Akt1s1-003; 3'UTR (exon 1)
ENSMUST00000054343 ; Akt1s1-201; intron 1
Database links

Mature sequence mmu-miR-707

Accession MIMAT0003497
Sequence

7 - 

cagucaugccgcuugccuacg

 - 27

Get sequence
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).