Stem-loop sequence mmu-mir-706

AccessionMI0004690 (change log)
Symbol MGI:Mir706
DescriptionMus musculus miR-706 stem-loop
Literature search

12 open access papers mention mmu-mir-706
(164 sentences)

Stem-loop
          cc                  -    aa  a   u 
5' agagaaa  cugucucaaaaaacaaaa aaac  ac aaa u
   |||||||  |||||||||||||||||| ||||  || ||| a
3' uuuuuuu  gguagaguuuuuuguuuu uuug  ug uuu c
          uc                  a    ga  a   u 
Get sequence
Deep sequencing
509 reads, 2.39e+03 reads per million, 79 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 120034228-120034311 [-]
sense
OTTMUST00000078356 ; Wnk1-001; intron 1
OTTMUST00000081827 ; Wnk1-005; intron 1
ENSMUST00000088646 ; Wnk1-202; intron 1
ENSMUST00000177761 ; Wnk1-203; intron 1
ENSMUST00000088644 ; Wnk1-201; intron 1
ENSMUST00000159397 ; Wnk1-005; intron 1
ENSMUST00000060043 ; Wnk1-001; intron 1
ENSMUST00000181872 ; Gm26591-201; exon 2
Database links

Mature sequence mmu-miR-706

Accession MIMAT0003496
Sequence

1 - 

agagaaacccugucucaaaaaa

 - 22

Get sequence
Deep sequencing92 reads, 46 experiments
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).