Stem-loop sequence mmu-mir-700

AccessionMI0004684 (change log)
Symbol MGI:Mir700
DescriptionMus musculus miR-700 stem-loop
Literature search

7 open access papers mention mmu-mir-700
(12 sentences)

Stem-loop
   uuc      a  aa     -c        cu     --ggg g 
5'    acuggg gu  ggcuc  uuccugug  ugcag     a a
      |||||| ||  |||||  ||||||||  |||||     |  
3'    ugaccc ca  cugag  aagggcgc  acguc     u a
   ---      c  -c     cc        --     aagca a 
Get sequence
Deep sequencing
9416 reads, 9.8 reads per million, 102 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 135416555-135416633 [-]
sense
OTTMUST00000070708 ; Rcan3-003; intron 3
OTTMUST00000022473 ; Rcan3-001; exon 5
ENSMUST00000132654 ; Rcan3-003; intron 3
ENSMUST00000030606 ; Rcan3-001; exon 5
Database links

Mature sequence mmu-miR-700-5p

Accession MIMAT0017256
Previous IDsmmu-miR-700*
Sequence

12 - 

uaaggcuccuuccugugcuugc

 - 33

Get sequence
Deep sequencing3752 reads, 97 experiments
Evidence experimental; 454 [3], Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-700-3p

Accession MIMAT0003490
Previous IDsmmu-miR-700
Sequence

53 - 

cacgcgggaaccgaguccacc

 - 73

Get sequence
Deep sequencing5619 reads, 98 experiments
Evidence experimental; MPSS [1], Illumina [2,4]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).