|
miRBase |
|
Stem-loop sequence mmu-mir-700 |
|||||
| Accession | MI0004684 | ||||
| Symbol | MGI:Mir700 | ||||
| Description | Mus musculus miR-700 stem-loop | ||||
| Stem-loop |
uuc a aa -c cu --ggg g acuggg gu ggcuc uuccugug ugcag a a |||||| || ||||| |||||||| ||||| | ugaccc ca cugag aagggcgc acguc u a --- c -c cc -- aagca a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence mmu-miR-700-5p |
|
| Accession | MIMAT0017256 |
| Previous IDs | mmu-miR-700* |
| Sequence |
12 - uaaggcuccuuccugugcuugc - 33 |
| Deep sequencing | 3129 reads, 74 experiments |
| Evidence | experimental; 454 [3], Solexa [4] |
| Predicted targets |
|
Mature sequence mmu-miR-700-3p |
|
| Accession | MIMAT0003490 |
| Previous IDs | mmu-miR-700 |
| Sequence |
53 - cacgcgggaaccgaguccacc - 73 |
| Deep sequencing | 3737 reads, 76 experiments |
| Evidence | experimental; MPSS [1], Solexa [2,4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
| 2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 3 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
| 4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|