Stem-loop sequence mmu-mir-491

AccessionMI0004680 (change log)
Symbol MGI:Mir491
DescriptionMus musculus miR-491 stem-loop
Gene family MIPF0000319; mir-491
Literature search

17 open access papers mention mmu-mir-491
(140 sentences)

Stem-loop
   aa ug      cu   a  u      cc   c          a 
5'   u  acuuag  ggg ag ggggaa  cuu caugaggagu g
     |  ||||||  ||| || ||||||  ||| |||||||||| a
3'   a  ugaguc  ucc uc ucccuu  gaa guauuccuca a
   -- gu      ag   a  u      -a   c          c 
Get sequence
Deep sequencing
1570 reads, 0 reads per million, 85 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 88122040-88122125 [+]
sense
OTTMUST00000086963 ; RP23-300P20.4-009; intron 1
OTTMUST00000086962 ; RP23-300P20.4-008; intron 2
OTTMUST00000026608 ; RP23-300P20.4-001; intron 2
ENSMUST00000159342 ; Focad-009; intron 1
ENSMUST00000097992 ; Focad-001; intron 2
ENSMUST00000161058 ; Focad-008; intron 2
Database links

Mature sequence mmu-miR-491-5p

Accession MIMAT0003486
Previous IDsmmu-miR-491
Sequence

18 - 

aguggggaacccuuccaugagg

 - 39

Get sequence
Deep sequencing1428 reads, 77 experiments
Evidence experimental; MPSS [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-491-3p

Accession MIMAT0017255
Previous IDsmmu-miR-491*
Sequence

52 - 

cuuaugcaagauucccuucuac

 - 73

Get sequence
Deep sequencing138 reads, 48 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).