Stem-loop sequence mmu-mir-499

AccessionMI0004676 (change log)
Symbol MGI:Mir499
DescriptionMus musculus miR-499 stem-loop
Gene family MIPF0000173; mir-499
Literature search

66 open access papers mention mmu-mir-499
(600 sentences)

Stem-loop
   gggu       u  ua        a          ---  uc 
5'     gggcagc gu  agacuugc gugauguuua   gc  c
       ||||||| ||  |||||||| ||||||||||   ||   
3'     uccgucg cg  ucugaacg cacuacaagu   cg  u
   ----       u  ug        a          gua  uc 
Get sequence
Deep sequencing
18282 reads, 83.1 reads per million, 83 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 155622880-155622958 [+]
sense
OTTMUST00000038477 ; Myh7b-001; intron 19
ENSMUST00000092995 ; Myh7b-001; intron 19
Database links

Mature sequence mmu-miR-499-5p

Accession MIMAT0003482
Previous IDsmmu-miR-499
Sequence

14 - 

uuaagacuugcagugauguuu

 - 34

Get sequence
Deep sequencing17523 reads, 82 experiments
Evidence experimental; MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-499-3p

Accession MIMAT0017254
Previous IDsmmu-miR-499*
Sequence

50 - 

gaacaucacagcaagucugugcu

 - 72

Get sequence
Deep sequencing759 reads, 28 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).