Stem-loop sequence mmu-mir-467b

AccessionMI0004671 (change log)
Symbol MGI:Mir467b
DescriptionMus musculus miR-467b stem-loop
Gene family MIPF0000316; mir-467
Literature search

24 open access papers mention mmu-mir-467b
(87 sentences)

Stem-loop
   cc     c  aa   cc  c             ua 
5'   gugug gu  gug  ug auguauaugcgug  u
     ||||| ||  |||  || |||||||||||||  a
3'   cacac ca  cac  ac uacauauacguau  u
   ua     a  ac   ac  a             uu 
Get sequence
Deep sequencing
95293 reads, 389 reads per million, 113 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The sequence of miR-467 is of low complexity. The sequence maps exactly to several genomic positions, and many more with 1 or 2 substitutions. Confidence in this miRNA might therefore be reduced.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10481248-10481320 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-467b
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
mmu-mir-669gchr2: 10477150-10477272 [+]
mmu-mir-669jchr2: 10477910-10478030 [+]
mmu-mir-467a-2chr2: 10478798-10478880 [+]
mmu-mir-466echr2: 10479088-10479171 [+]
mmu-mir-669a-4chr2: 10479315-10479401 [+]
mmu-mir-467bchr2: 10481248-10481320 [+]
mmu-mir-466c-1chr2: 10481534-10481617 [+]
mmu-mir-669a-5chr2: 10481761-10481847 [+]
mmu-mir-467a-3chr2: 10483678-10483760 [+]
mmu-mir-466c-2chr2: 10483966-10484055 [+]
mmu-mir-669a-6chr2: 10484196-10484282 [+]
mmu-mir-467a-4chr2: 10486135-10486217 [+]
mmu-mir-466b-4chr2: 10486423-10486512 [+]
mmu-mir-669a-7chr2: 10486653-10486739 [+]
mmu-mir-467a-5chr2: 10488599-10488681 [+]
mmu-mir-466b-5chr2: 10488887-10488974 [+]
mmu-mir-669p-1chr2: 10489116-10489202 [+]
mmu-mir-467a-6chr2: 10491048-10491130 [+]
Database links

Mature sequence mmu-miR-467b-5p

Accession MIMAT0005448
Previous IDsmmu-miR-467b
Sequence

9 - 

guaagugccugcauguauaug

 - 29

Get sequence
Deep sequencing80115 reads, 101 experiments
Evidence experimental; MPSS [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-467b-3p

Accession MIMAT0003478
Previous IDsmmu-miR-467b;mmu-miR-467b*
Sequence

46 - 

auauacauacacacaccaacac

 - 67

Get sequence
Deep sequencing15176 reads, 107 experiments
Evidence experimental; Illumina [2-3]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).