Stem-loop sequence mmu-mir-146b

Accession MI0004665
Symbol MGI:Mir146b
Description Mus musculus miR-146b stem-loop
Gene family MIPF0000103; mir-146
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-146. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-146 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-146 is primarily involved in the regulation of inflammation and other process that function in the innate immune system. Loss of functional miR-146 (and mir-145) could predispose an individual to suffer from chromosome 5q deletion syndrome. miR-146 has also been reported to be highly upregulated in osteoarthritis cartilage, and could be involved in its pathogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gacugagagaacuu    -  -  u   u  g        a    a    c   ga  u 
              uggc ca cc ggc cu agaacuga uucc uagg ugu  gc c
              |||| || || ||| || |||||||| |||| |||| |||  ||  
              aucg gu gg ccg gg ucuugacu aggg aucc gca  cg u
-------cuaccau    u  c  c   u  -        c    -    c   ga  a 
Get sequence
Deep sequencing
1049875 reads, 96 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr19: 46342762-46342870 [+]
sense
OTTMUST00000082701 ; Tmem180-003; intron 1
ENSMUST00000128041 ; Tmem180-003; intron 1
Database links

Mature sequence mmu-miR-146b-5p

Accession MIMAT0003475
Previous IDs mmu-miR-146b
Sequence

29 - 

ugagaacugaauuccauaggcu

 - 50

Get sequence
Deep sequencing 1041318 reads, 81 experiments
Evidence experimental; MPSS [1], cloned [2], Solexa [3-4]
Predicted targets

Mature sequence mmu-miR-146b-3p

Accession MIMAT0004826
Previous IDs mmu-miR-146b*
Sequence

67 - 

gcccuagggacucaguucuggu

 - 88

Get sequence
Deep sequencing 908 reads, 45 experiments
Evidence experimental; cloned [2], Solexa [3-4]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).