Stem-loop sequence mmu-mir-692-2

AccessionMI0004661 (change log)
Symbol MGI:Mir692-2
DescriptionMus musculus miR-692-2 stem-loop
Gene family MIPF0000336; mir-692
Literature search

3 open access papers mention mmu-mir-692-2
(4 sentences)

Stem-loop
   gguggcagggccacaacca       cuggcgcgccccagggaucucugggcgaguaucu 
5'                    gcgcaga                                  c
                      |||||||                                  u
3'                    cgugucu                                  u
   --------------ccuuc       ccggaggaucagcacgaacucucacuccgcgagu 
Get sequence
Deep sequencing
273 reads, 12.5 reads per million, 48 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 125504749-125504857 [+]
sense
OTTMUST00000020938 ; Grik3-001; intron 1
OTTMUST00000021336 ; Ftl2-001; exon 1
ENSMUST00000030676 ; Grik3-001; intron 1
ENSMUST00000118517 ; Ftl2-001; exon 1
Database links

Mature sequence mmu-miR-692

Accession MIMAT0003471
Sequence

57 - 

aucucuuugagcgccucacuc

 - 77

Get sequence
Deep sequencing159 reads, 18 experiments
Evidence experimental; MPSS [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).