Stem-loop sequence mmu-mir-692-1

AccessionMI0004660 (change log)
Symbol MGI:Mir692-1
DescriptionMus musculus miR-692-1 stem-loop
Gene family MIPF0000336; mir-692
Literature search

5 open access papers mention mmu-mir-692-1
(6 sentences)

Stem-loop
   a   u     -    a ---aacca  -gc   c   c    - cc      -   u 
5'  ggg ggcag ggcc c        gc   aga ugg gcgc c  agggau cuc g
    ||| ||||| |||| |        ||   ||| ||| |||| |  |||||| ||| g
3'  ccu ccguc ccgg g        cg   ucu acu cgcg g  ucucua gag g
   -   u     u    a gaucaaca  aac   c   c    a uu      u   u 
Get sequence
Deep sequencing
202 reads, 12.5 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 6895229-6895337 [-]
intergenic
Database links

Mature sequence mmu-miR-692

Accession MIMAT0003471
Sequence

59 - 

aucucuuugagcgccucacuc

 - 79

Get sequence
Deep sequencing159 reads, 18 experiments
Evidence experimental; MPSS [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).