Stem-loop sequence mmu-mir-691

AccessionMI0004659 (change log)
Symbol MGI:Mir691
DescriptionMus musculus miR-691 stem-loop
Literature search

8 open access papers mention mmu-mir-691
(28 sentences)

Stem-loop
   --------gc    uua       -       cuu   ----  ug 
5'           ugau   uuuuugc uuucuuc   ggg    uc  c
             ||||   ||||||| |||||||   |||    ||   
3'           auug   aaagacg agagaag   ccu    ag  u
   uauaauuuau    -ua       g       --u   uaua  uu 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 74341990-74342067 [-]
sense
OTTMUST00000041281 ; Robo2-004; intron 2
OTTMUST00000041282 ; Robo2-002; intron 2
OTTMUST00000041283 ; Robo2-001; intron 2
OTTMUST00000071400 ; Robo2-005; intron 2
ENSMUST00000117785 ; Robo2-001; intron 2
ENSMUST00000117200 ; Robo2-004; intron 2
ENSMUST00000116586 ; Robo2-002; intron 2
ENSMUST00000140062 ; Robo2-005; intron 2
Database links

Mature sequence mmu-miR-691

Accession MIMAT0003470
Sequence

42 - 

auuccugaagagaggcagaaaa

 - 63

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).