Stem-loop sequence mmu-mir-690

AccessionMI0004658 (change log)
Symbol MGI:Mir690
DescriptionMus musculus miR-690 stem-loop
Literature search

15 open access papers mention mmu-mir-690
(53 sentences)

Stem-loop
           u  --g     aau     gua    agu   aguaa  aa   -     uc 
5' uguguuuu gu   gagcu   uggcu   uuaa   gcu     ga  cau ucucc  c
   |||||||| ||   |||||   |||||   ||||   |||     ||  ||| |||||  a
3' auauaaaa ca   cucgg   aucgg   aauu   cga     cu  gua agagg  g
           c  aca     ---     --a    -gu   -----  cg   g     uc 
Get sequence
Deep sequencing
11865 reads, 557 reads per million, 109 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 28599935-28600043 [-]
intergenic
Database links

Mature sequence mmu-miR-690

Accession MIMAT0003469
Sequence

83 - 

aaaggcuaggcucacaaccaaa

 - 104

Get sequence
Deep sequencing4171 reads, 96 experiments
Evidence experimental; MPSS [1]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).