Stem-loop sequence mmu-mir-683-1

AccessionMI0004646 (change log)
Previous IDsmmu-mir-683
Symbol MGI:Mir683-1
DescriptionMus musculus miR-683-1 stem-loop
Gene family MIPF0000712; mir-683
Literature search

2 open access papers mention mmu-mir-683-1
(4 sentences)

Stem-loop
   u   --aa  c   - ug     c      gg  -c     uaaaagccaagcuuu 
5'  ggg    gu cag c  ggagg ugcagu  ac  caggc               u
    |||    || ||| |  ||||| ||||||  ||  |||||                
3'  ccc    ua guc g  ccucc gugucg  ug  guccg               c
   -   gagg  c   g gu     u      aa  uc     uaggugacgucacgu 
Get sequence
Deep sequencing
18 reads, 37.5 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 50544626-50544734 [-]
intergenic
Database links

Mature sequence mmu-miR-683

Accession MIMAT0003461
Sequence

71 - 

ccugcuguaagcuguguccuc

 - 91

Get sequence
Deep sequencing10 reads, 5 experiments
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).