Stem-loop sequence mmu-mir-449c

AccessionMI0004645 (change log)
Previous IDsmmu-mir-449b
Symbol MGI:Mir449c
DescriptionMus musculus miR-449c stem-loop
Gene family MIPF0000133; mir-449
Literature search

48 open access papers mention mmu-mir-449c
(279 sentences)

Stem-loop
   a g   aag g        u    ca  c      uu      u       -a  ac 
5'  g aug   u ugggugug cagg  gg agugca  gcuagc ggcuguu  ga  u
    | |||   | |||||||| ||||  || ||||||  |||||| |||||||  ||   
3'  c uac   a acucacgu gucu  cc ucacgu  cgaucg uugacaa  cu  u
   - g   -ga g        c    -c  a      --      -       cc  au 
Get sequence
Deep sequencing
4043 reads, 52.5 reads per million, 80 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 113035983-113036091 [+]
sense
OTTMUST00000112400 ; Cdc20b-004; intron 2
OTTMUST00000112401 ; Cdc20b-002; intron 2
OTTMUST00000112402 ; Cdc20b-005; intron 2
OTTMUST00000112399 ; Cdc20b-001; intron 2
OTTMUST00000112403 ; Cdc20b-003; intron 2
ENSMUST00000180543 ; Cdc20b-004; intron 2
ENSMUST00000181568 ; Cdc20b-002; intron 2
ENSMUST00000109244 ; Cdc20b-005; intron 2
ENSMUST00000181117 ; Cdc20b-001; intron 2
ENSMUST00000181741 ; Cdc20b-003; intron 2
Clustered miRNAs
< 10kb from mmu-mir-449c
mmu-mir-449cchr13: 113035983-113036091 [+]
mmu-mir-449bchr13: 113037419-113037498 [+]
mmu-mir-449achr13: 113037534-113037624 [+]
Database links

Mature sequence mmu-miR-449c-5p

Accession MIMAT0003460
Previous IDsmmu-miR-449b;mmu-miR-449c
Sequence

26 - 

aggcagugcauugcuagcugg

 - 46

Get sequence
Deep sequencing3978 reads, 80 experiments
Evidence experimental; MPSS [1], Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-449c-3p

Accession MIMAT0022715
Sequence

67 - 

caguugcuagcugcacuacccu

 - 88

Get sequence
Deep sequencing34 reads, 12 experiments
Evidence not experimental
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).