Stem-loop sequence mmu-mir-682

AccessionMI0004644 (change log)
Symbol MGI:Mir682
DescriptionMus musculus miR-682 stem-loop
Literature search

5 open access papers mention mmu-mir-682
(89 sentences)

Stem-loop
   gccguc    -u  gg        uuc     u  aaaca    -ccg cg  gc 
5'       ggca  cu  cacugugg   cugca ga     gugg    g  gg  c
         ||||  ||  ||||||||   ||||| ||     ||||    |  ||  u
3'       ccgu  ga  gugacacu   gacgu cu     cacc    c  cc  g
   ------    cu  -a        ---     -  ----c    acaa au  ag 
Get sequence
Deep sequencing
103 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 75645046-75645141 [+]
sense
ENSMUST00000099371 ; Gm4149-201; exon 1
Database links

Mature sequence mmu-miR-682

Accession MIMAT0003459
Sequence

74 - 

cugcagucacagugaagucug

 - 94

Get sequence
Deep sequencing12 reads, 10 experiments
Evidence experimental; MPSS [1], Illumina [2]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).