Stem-loop sequence mmu-mir-681

AccessionMI0004643 (change log)
Symbol MGI:Mir681
DescriptionMus musculus miR-681 stem-loop
Literature search

5 open access papers mention mmu-mir-681
(6 sentences)

Stem-loop
   g    ---        c    ----a   cca     u     -uc      -  u  ccc 
5'  cagc   cucgcugg aggc     gcu   gagug ggcug   cucauc ac cu   u
    ||||   |||||||| ||||     |||   ||||| |||||   |||||| || ||    
3'  guug   gggcgacc uccg     uga   cucac uugac   ggguag ug ga   a
   -    aca        -    ggacc   -cg     -     uuu      a  -  cga 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 69763835-69763944 [-]
sense
ENSMUST00000021377 ; Cdkl1-201; intron 3
Database links

Mature sequence mmu-miR-681

Accession MIMAT0003458
Sequence

2 - 

cagccucgcuggcaggcagcu

 - 22

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).