Stem-loop sequence mmu-mir-680-3

AccessionMI0004642 (change log)
Symbol MGI:Mir680-3
DescriptionMus musculus miR-680-3 stem-loop
Gene family MIPF0000338; mir-680
Literature search

8 open access papers mention mmu-mir-680-3
(11 sentences)

Stem-loop
   gggggauuuaacaaagaacaaaa        ---c        aca     g aga 
5'                        aagguggg    aucugcug   ugggg c   a
                          ||||||||    ||||||||   ||||| |    
3'                        uucuacuu    uggacgac   aucuc g   g
   -----------------------        cuca        -gg     g acu 
Get sequence
Deep sequencing
10 reads, 1.92e+03 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 35194811-35194897 [-]
intergenic
Database links

Mature sequence mmu-miR-680

Accession MIMAT0003457
Sequence

29 - 

gggcaucugcugacauggggg

 - 49

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).