Stem-loop sequence mmu-mir-680-1

AccessionMI0004640 (change log)
Symbol MGI:Mir680-1
DescriptionMus musculus miR-680-1 stem-loop
Gene family MIPF0000338; mir-680
Literature search

7 open access papers mention mmu-mir-680-1
(10 sentences)

Stem-loop
   aga   -g       ---    a  u    gc   -ag  a  c cc    a    g 
5'    agu  ggcaucu   gcug ca gggg  cga   uc gg g  agga gcgg c
      |||  |||||||   |||| || ||||  |||   || || |  |||| |||| a
3'    ucg  cuguggg   cgac gu cucc  gcu   ag cc c  uucu cguu c
   ---   ga       uuc    a  u    ua   aca  g  u ua    a    u 
Get sequence
Deep sequencing
42 reads, 5.56 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 129691535-129691643 [+]
intergenic
Database links

Mature sequence mmu-miR-680

Accession MIMAT0003457
Sequence

7 - 

gggcaucugcugacauggggg

 - 27

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; MPSS [1]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).