Stem-loop sequence mmu-mir-679

AccessionMI0004638 (change log)
Symbol MGI:Mir679
DescriptionMus musculus miR-679 stem-loop
Gene family MIPF0001564; mir-679
Literature search

1 open access papers mention mmu-mir-679
(4 sentences)

Stem-loop
   c       uugg         -u   u    g  ---u  g 
5'  uauggcu    acugugagg  gac cuug ug    gu a
    |||||||    |||||||||  ||| |||| ||    ||  
3'  auaucga    ugacacucc  cug gaac ac    cg u
   -       ----         uc   -    g  uuuu  g 
Get sequence
Deep sequencing
4537 reads, 41.8 reads per million, 55 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109715577-109715650 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-679
mmu-mir-379chr12: 109709060-109709125 [+]
mmu-mir-411chr12: 109710175-109710256 [+]
mmu-mir-299achr12: 109710638-109710700 [+]
mmu-mir-299bchr12: 109710645-109710693 [-]
mmu-mir-380chr12: 109711803-109711863 [+]
mmu-mir-1197chr12: 109712317-109712436 [+]
mmu-mir-323chr12: 109712508-109712593 [+]
mmu-mir-758chr12: 109712810-109712890 [+]
mmu-mir-329chr12: 109713481-109713577 [+]
mmu-mir-494chr12: 109715318-109715402 [+]
mmu-mir-679chr12: 109715577-109715650 [+]
mmu-mir-1193chr12: 109715671-109715791 [+]
mmu-mir-666chr12: 109717085-109717183 [+]
mmu-mir-543chr12: 109717258-109717333 [+]
mmu-mir-495chr12: 109718754-109718816 [+]
mmu-mir-667chr12: 109720006-109720097 [+]
mmu-mir-376cchr12: 109722718-109722803 [+]
mmu-mir-654chr12: 109723218-109723301 [+]
mmu-mir-376bchr12: 109723458-109723539 [+]
mmu-mir-376achr12: 109723781-109723848 [+]
mmu-mir-300chr12: 109724313-109724391 [+]
Database links

Mature sequence mmu-miR-679-5p

Accession MIMAT0003455
Previous IDsmmu-miR-679
Sequence

11 - 

ggacugugaggugacucuuggu

 - 32

Get sequence
Deep sequencing3681 reads, 42 experiments
Evidence experimental; MPSS [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-679-3p

Accession MIMAT0017248
Sequence

48 - 

agcaagguccuccucacaguag

 - 69

Get sequence
Deep sequencing826 reads, 41 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).