Stem-loop sequence mmu-mir-423

AccessionMI0004637 (change log)
Symbol MGI:Mir423
DescriptionMus musculus miR-423 stem-loop
Gene family MIPF0000329; mir-423
Literature search

34 open access papers mention mmu-mir-423
(138 sentences)

Stem-loop
   acuu   a  aaauaa       u            -ag   g    a     cua 
5'     gug gg      aggaagu aggcugaggggc   aga cgag cuuuu   u
       ||| ||      ||||||| ||||||||||||   ||| |||| |||||   u
3'     cgc cc      uccuucg ucugacuccccg   ucu gcuc gaaaa   u
   -guu   g  ---cca       u            gag   g    -     ccu 
Get sequence
Deep sequencing
2053926 reads, 4.62e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 77078064-77078172 [-]
sense
OTTMUST00000014093 ; Ccdc55-001; intron 1
OTTMUST00000014095 ; Ccdc55-003; intron 1
ENSMUST00000134685 ; Ccdc55-003; intron 1
ENSMUST00000102494 ; Ccdc55-001; intron 1
Database links

Mature sequence mmu-miR-423-5p

Accession MIMAT0004825
Sequence

29 - 

ugaggggcagagagcgagacuuu

 - 51

Get sequence
Deep sequencing1859917 reads, 108 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-423-3p

Accession MIMAT0003454
Previous IDsmmu-miR-423
Sequence

65 - 

agcucggucugaggccccucagu

 - 87

Get sequence
Deep sequencing193972 reads, 107 experiments
Evidence experimental; MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).