Stem-loop sequence mmu-mir-497a

AccessionMI0004636 (change log)
Previous IDsmmu-mir-497
DescriptionMus musculus miR-497 stem-loop
Gene family MIPF0000231; mir-497
Literature search

45 open access papers mention mmu-mir-497a
(603 sentences)

Stem-loop
   cc     c   c c    g    c         u  --   ac 
5'   ugccc cgc c agca caca ugugguuug ac  ggc  u
     ||||| ||| | |||| |||| ||||||||| ||  |||   
3'   auggg gcg g uugu gugu acaccaaac ug  ccg  g
   --     a   a a    g    c         c  ca   gu 
Get sequence
Deep sequencing
92702 reads, 615 reads per million, 109 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 70234717-70234800 [+]
antisense
ENSMUST00000093601 ; Mir497-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-497a
mmu-mir-497bchr11: 70234692-70234816 [-]
mmu-mir-497achr11: 70234717-70234800 [+]
mmu-mir-195achr11: 70235042-70235135 [+]
Database links

Mature sequence mmu-miR-497a-5p

Accession MIMAT0003453
Previous IDsmmu-miR-497-5p
Sequence

14 - 

cagcagcacacugugguuugua

 - 35

Get sequence
Deep sequencing91194 reads, 102 experiments
Evidence experimental; MPSS [1], cloned [2], Illumina [3,5]
Database links
Predicted targets

Mature sequence mmu-miR-497a-3p

Accession MIMAT0017247
Previous IDsmmu-miR-497-3p
Sequence

54 - 

caaaccacacugugguguuag

 - 74

Get sequence
Deep sequencing1304 reads, 45 experiments
Evidence experimental; 454 [4], Illumina [5]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).