Stem-loop sequence mmu-mir-677

AccessionMI0004634 (change log)
Symbol MGI:Mir677
DescriptionMus musculus miR-677 stem-loop
Gene family MIPF0000811; mir-677
Literature search

3 open access papers mention mmu-mir-677
(6 sentences)

Stem-loop
   gag   --    ug   auua  u    a    ----c    u 
5'    ccu  ucag  aug    gc ucug cuuu     guuc u
      |||  ||||  |||    || |||| ||||     ||||  
3'    gga  aguc  ugc    cg agac gaag     uaag c
   agg   ag    cu   ----  u    c    ucguu    u 
Get sequence
Deep sequencing
4878 reads, 8.79 reads per million, 91 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 128085286-128085363 [+]
sense
OTTMUST00000057842 ; Atp5b-003; intron 1
OTTMUST00000057840 ; Atp5b-001; intron 4
ENSMUST00000139295 ; Atp5b-003; intron 1
ENSMUST00000026459 ; Atp5b-001; intron 4
Database links

Mature sequence mmu-miR-677-5p

Accession MIMAT0003451
Previous IDsmmu-miR-677
Sequence

6 - 

uucagugaugauuagcuucuga

 - 27

Get sequence
Deep sequencing4693 reads, 85 experiments
Evidence experimental; MPSS [1], Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-677-3p

Accession MIMAT0017246
Previous IDsmmu-miR-677*
Sequence

50 - 

gaagccagaugccguuccugagaagg

 - 75

Get sequence
Deep sequencing115 reads, 43 experiments
Evidence experimental; 454 [3]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).