Stem-loop sequence mmu-mir-488

AccessionMI0004633 (change log)
Symbol MGI:Mir488
DescriptionMus musculus miR-488 stem-loop
Gene family MIPF0000318; mir-488
Literature search

11 open access papers mention mmu-mir-488
(57 sentences)

Stem-loop
         u    g     a  c   cu  c   u      a  c        guu 
5' uucggg gaga ugaga uc ucu  cc aga aauagc cu ucaaacaa   u
   |||||| |||| ||||| || |||  || ||| |||||| || ||||||||   c
3' aggucu cuuu acucu ag aga  gg ucu uugucg ga aguuuguu   c
         u    a     c  a   cu  u   -      -  a        gua 
Get sequence
Deep sequencing
12009 reads, 29.2 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 158505625-158505733 [+]
sense
ENSMUST00000046110 ; Astn1-201; intron 5
ENSMUST00000170718 ; Astn1-202; intron 5
Database links

Mature sequence mmu-miR-488-5p

Accession MIMAT0003449
Previous IDsmmu-miR-488;mmu-miR-488*
Sequence

27 - 

cccagauaauagcacucucaa

 - 47

Get sequence
Deep sequencing288 reads, 21 experiments
Evidence experimental; Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-488-3p

Accession MIMAT0003450
Previous IDsmmu-miR-488*;mmu-miR-488
Sequence

65 - 

uugaaaggcuguuucuugguc

 - 85

Get sequence
Deep sequencing11715 reads, 45 experiments
Evidence experimental; MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).