Stem-loop sequence mmu-mir-344d-2

AccessionMI0004619 (change log)
Symbol MGI:Mir344d-2
DescriptionMus musculus miR-344d-2 stem-loop
Gene family MIPF0000267; mir-344
Literature search

10 open access papers mention mmu-mir-344d-2
(34 sentences)

Stem-loop
   agauu    -         u c   c     u        u 
5'      ucau uagucuggu g ugg uauau ccaggacu a
        |||| ||||||||| | ||| ||||| |||||||| u
3'      ggua gucagaccg c acc auaua gguccugg c
   --cgu    a         u -   a     -        u 
Get sequence
Deep sequencing
11070 reads, 8.51 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by sequencing [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 61685272-61685351 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-344d-2
mmu-mir-344d-2chr7: 61685272-61685351 [-]
mmu-mir-344d-1chr7: 61683124-61683192 [-]
Database links

Mature sequence mmu-miR-344d-2-5p

Accession MIMAT0014961
Previous IDsmmu-miR-344d-2*
Sequence

11 - 

agucugguugcuggcuauauucca

 - 34

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mmu-miR-344d-3p

Accession MIMAT0014808
Previous IDsmmu-miR-344d
Sequence

52 - 

gauauaaccacugccagacuga

 - 73

Get sequence
Deep sequencing33184 reads, 47 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).