Stem-loop sequence mmu-mir-674

AccessionMI0004611 (change log)
Symbol MGI:Mir674
DescriptionMus musculus miR-674 stem-loop
Gene family MIPF0000394; mir-674
Literature search

10 open access papers mention mmu-mir-674
(67 sentences)

Stem-loop
      cu  u  u     u        ca             g     ag  u 
5' ggc  ag ca caccc gagccuug  cugagaugggagu gugua  gc c
   |||  || || ||||| ||||||||  ||||||||||||| |||||  ||  
3' ucg  uc gu guggg cucggaac  gacucuacccucg cacgu  ug a
      ac  -  -     -        aa             a     -a  g 
Get sequence
Deep sequencing
48963 reads, 103 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Landgraf et al. show that the 5' miRNA product is the predominant one [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 117185127-117185226 [+]
intergenic
Database links

Mature sequence mmu-miR-674-5p

Accession MIMAT0003740
Previous IDsmmu-miR-674-5p;mmu-miR-674
Sequence

25 - 

gcacugagaugggaguggugua

 - 46

Get sequence
Deep sequencing30637 reads, 104 experiments
Evidence experimental; MPSS [1], cloned [2,4], miRAP-cloned [3], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-674-3p

Accession MIMAT0003741
Previous IDsmmu-miR-674-3p;mmu-miR-674*
Sequence

60 - 

cacagcucccaucucagaacaa

 - 81

Get sequence
Deep sequencing18147 reads, 106 experiments
Evidence experimental; MPSS [1], cloned [2,4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
3
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).