Stem-loop sequence mmu-mir-760

AccessionMI0004605 (change log)
Symbol MGI:Mir760
DescriptionMus musculus miR-760 stem-loop
Gene family MIPF0000395; mir-760
Literature search

6 open access papers mention mmu-mir-760
(126 sentences)

Stem-loop
       ag    ccuc   gc   gc  --g    c    u      ac       c    acc 
5' cggg  gaug    ggu  ggg  gc   ucgc cccc caggcc  cagagcc ggau   u
   ||||  ||||    |||  |||  ||   |||| |||| ||||||  ||||||| ||||   c
3' gccc  uugc    cca  ccc  cg   agcg gggg gucugg  gucucgg cuua   a
       cu    ---c   aa   aa  uaa    a    u      --       -    aag 
Get sequence
Deep sequencing
21716 reads, 10.3 reads per million, 97 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 122293585-122293703 [-]
intergenic
Database links

Mature sequence mmu-miR-760-5p

Accession MIMAT0017245
Sequence

33 - 

ccccucaggccaccagagcccgg

 - 55

Get sequence
Deep sequencing94 reads, 22 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-760-3p

Accession MIMAT0003898
Previous IDsmmu-miR-760
Sequence

70 - 

cggcucugggucugugggga

 - 89

Get sequence
Deep sequencing19672 reads, 92 experiments
Evidence experimental; cloned [1-2], RAKE [1], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).