Stem-loop sequence mmu-mir-673

AccessionMI0004601 (change log)
Symbol MGI:Mir673
DescriptionMus musculus miR-673 stem-loop
Gene family MIPF0000405; mir-673
Literature search

9 open access papers mention mmu-mir-673
(10 sentences)

Stem-loop
   u    cc       --cu     --   u      u     uc  ga 
5'  ggag  ugagggg    cacag  cuc gguccu ggagc  ca  g
    ||||  |||||||    |||||  ||| |||||| |||||  ||  a
3'  ccuc  guucccc    guguc  gag ucgggg ccucg  gu  a
   a    cc       ccac     uu   -      -     uu  aa 
Get sequence
Deep sequencing
37588 reads, 155 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109571990-109572080 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-673
mmu-mir-770chr12: 109563692-109563785 [+]
mmu-mir-673chr12: 109571990-109572080 [+]
mmu-mir-493chr12: 109580233-109580315 [+]
Database links

Mature sequence mmu-miR-673-5p

Accession MIMAT0003739
Previous IDsmmu-miR-673
Sequence

15 - 

cucacagcucugguccuuggag

 - 36

Get sequence
Deep sequencing32783 reads, 75 experiments
Evidence experimental; MPSS [1], cloned [2,4], miRAP-cloned [3], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-673-3p

Accession MIMAT0004824
Sequence

55 - 

uccggggcugaguucugugcacc

 - 77

Get sequence
Deep sequencing4793 reads, 46 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
3
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).