Stem-loop sequence mmu-mir-496a

AccessionMI0004589 (change log)
Previous IDsmmu-mir-496
Symbol MGI:Mir496a
DescriptionMus musculus miR-496 stem-loop
Gene family MIPF0000018; mir-154
Literature search

6 open access papers mention mmu-mir-496a
(12 sentences)

Stem-loop
        u    u        c     gu         uua 
5' agugu cgaa ggagguug ccaug  guguucauu   u
   ||||| |||| |||||||| |||||  |||||||||    
3' ucacg gcuu ccucuaac gguac  uaugaguag   u
        -    u        c     au         uau 
Get sequence
Deep sequencing
11080 reads, 112 reads per million, 66 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109739119-109739197 [+]
sense
OTTMUST00000113369 ; Mirg-006; intron 1
OTTMUST00000113370 ; Mirg-002; intron 1
OTTMUST00000113366 ; Mirg-004; intron 2
OTTMUST00000113367 ; Mirg-001; intron 2
OTTMUST00000113368 ; Mirg-005; intron 2
OTTMUST00000114051 ; Mirg-010; intron 7
OTTMUST00000114052 ; Mirg-009; intron 8
OTTMUST00000114049 ; Mirg-011; intron 11
ENSMUST00000182231 ; Mirg-006; intron 1
ENSMUST00000181496 ; Mirg-002; intron 1
ENSMUST00000182268 ; Mirg-004; intron 2
ENSMUST00000181543 ; Mirg-001; intron 2
ENSMUST00000183116 ; Mirg-005; intron 2
ENSMUST00000182185 ; Mirg-010; intron 7
ENSMUST00000182499 ; Mirg-009; intron 8
ENSMUST00000183144 ; Mirg-011; intron 11
Clustered miRNAs
< 10kb from mmu-mir-496a
mmu-mir-544chr12: 109729325-109729402 [+]
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
mmu-mir-154chr12: 109738433-109738498 [+]
mmu-mir-496achr12: 109739119-109739197 [+]
mmu-mir-377chr12: 109740510-109740577 [+]
mmu-mir-541chr12: 109742409-109742498 [+]
mmu-mir-409chr12: 109743158-109743236 [+]
mmu-mir-412chr12: 109743289-109743368 [+]
mmu-mir-369chr12: 109743418-109743496 [+]
mmu-mir-410chr12: 109743715-109743795 [+]
mmu-mir-3072chr12: 109747878-109747960 [+]
Database links

Mature sequence mmu-miR-496a-5p

Accession MIMAT0017244
Previous IDsmmu-miR-496*;mmu-miR-496-5p
Sequence

14 - 

agguugcccaugguguguuca

 - 34

Get sequence
Deep sequencing58 reads, 24 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-496a-3p

Accession MIMAT0003738
Previous IDsmmu-miR-496;mmu-miR-496-3p
Sequence

47 - 

ugaguauuacauggccaaucuc

 - 68

Get sequence
Deep sequencing11022 reads, 65 experiments
Evidence experimental; MPSS [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).