Stem-loop sequence mmu-mir-763

AccessionMI0004516 (change log)
Symbol MGI:Mir763
DescriptionMus musculus miR-763 stem-loop
Gene family MIPF0000722; mir-763
Literature search

2 open access papers mention mmu-mir-763
(3 sentences)

Stem-loop
         gga   -gc           -    a      a ca       a aac   u      
5' aaugau   ggu   aggcguuuccu gggg uuaaug c  gcuggga g   cag ggccc 
   ||||||   |||   ||||||||||| |||| |||||| |  ||||||| |   ||| |||| u
3' uugcug   ucg   ucuguaaagga ccuc aauuac g  cgacccu c   guc ucggc 
         gag   uuu           a    -      c ac       c ---   -      
Get sequence
Deep sequencing
13 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 120447991-120448110 [-]
sense
OTTMUST00000083149 ; Hmga2-001; intron 3
OTTMUST00000083150 ; Hmga2-002; intron 3
ENSMUST00000072777 ; Hmga2-001; intron 3
ENSMUST00000159699 ; Hmga2-002; intron 3
Database links

Mature sequence mmu-miR-763

Accession MIMAT0003896
Sequence

38 - 

ccagcugggaagaaccaguggc

 - 59

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Northern [1], RAKE [1]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).