Stem-loop sequence mmu-mir-3099

AccessionMI0004485 (change log)
Symbol MGI:Mir3099
DescriptionMus musculus miR-3099 stem-loop
Gene family MIPF0001559; mir-3099
Literature search

5 open access papers mention mmu-mir-3099
(70 sentences)

Stem-loop
      ga          -      c   c    cu  a   uuu 
5' auc  uccccauccc agcuuc uuc agcc  ug ugu   a
   |||  |||||||||| |||||| ||| ||||  || |||    
3' uag  agggguaggg uuggag gag ucgg  ac acg   g
      aa          g      a   a    au  -   cau 
Get sequence
Deep sequencing
30263 reads, 154 reads per million, 56 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by sequencing [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 6803587-6803670 [+]
intergenic
Database links

Mature sequence mmu-miR-3099-5p

Accession MIMAT0014815
Previous IDsmmu-miR-3099*
Sequence

14 - 

ccagcuuccuuccagcccuug

 - 34

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; Illumina [2-3]
Database links
Predicted targets

Mature sequence mmu-miR-3099-3p

Accession MIMAT0014816
Previous IDsmmu-miR-3099
Sequence

52 - 

uaggcuagagagagguugggga

 - 73

Get sequence
Deep sequencing30243 reads, 51 experiments
Evidence experimental; Illumina [2-3]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).