Stem-loop sequence mmu-mir-3059

AccessionMI0004412 (change log)
Symbol MGI:Mir3059
DescriptionMus musculus miR-3059 stem-loop
Gene family MIPF0001766; mir-3059
Literature search

1 open access papers mention mmu-mir-3059
(1 sentences)

Stem-loop
   -   g  a     uuu   -    gc   a     u    cu 
5'  ggu gu cgccc   ccu cucu  ccc uaggg guag  c
    ||| || |||||   ||| ||||  ||| ||||| ||||   
3'  ccg ca guggg   gga gaga  ggg aucuc cauc  u
   u   a  a     -uu   a    -a   -     c    aa 
Get sequence
Deep sequencing
687 reads, 4 reads per million, 25 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by sequencing [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 101772692-101772772 [+]
sense
OTTMUST00000079100 ; Mgat4c-007; intron 1
OTTMUST00000079092 ; Mgat4c-004; intron 1
OTTMUST00000079093 ; Mgat4c-005; intron 1
OTTMUST00000079094 ; Mgat4c-006; intron 1
ENSMUST00000146230 ; Mgat4c-005; intron 1
ENSMUST00000134930 ; Mgat4c-007; intron 1
ENSMUST00000127504 ; Mgat4c-006; intron 1
ENSMUST00000156751 ; Mgat4c-004; intron 1
ENSMUST00000179929 ; Mgat4c-202; intron 1
Database links

Mature sequence mmu-miR-3059-5p

Accession MIMAT0014811
Previous IDsmmu-miR-3059
Sequence

13 - 

uuuccucucugccccauagggu

 - 34

Get sequence
Deep sequencing637 reads, 24 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-3059-3p

Accession MIMAT0014812
Previous IDsmmu-miR-3059*
Sequence

49 - 

ccucuagggaagagaagguugg

 - 70

Get sequence
Deep sequencing49 reads, 10 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).