Stem-loop sequence mmu-mir-764

AccessionMI0004310 (change log)
Symbol MGI:Mir764
DescriptionMus musculus miR-764 stem-loop
Gene family MIPF0000707; mir-764
Literature search

1 open access papers mention mmu-mir-764
(2 sentences)

Stem-loop
   u    ac    ug    u   a     g   u   -   u           cuua 
5'  caac  aauc  aauc ugg ggcag ugc cac aug ccuccuccaug    u
    ||||  ||||  |||| ||| ||||| ||| ||| ||| |||||||||||     
3'  guug  uuag  uuag acc cuguc acg gug uac ggaggagguac    a
   g    cu    --    u   a     a   -   a   c           auaa 
Get sequence
Deep sequencing
528 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 147002259-147002366 [+]
sense
OTTMUST00000045550 ; Htr2c-004; intron 2
OTTMUST00000045548 ; Htr2c-002; intron 2
OTTMUST00000045549 ; Htr2c-003; intron 2
OTTMUST00000045553 ; Htr2c-007; intron 2
OTTMUST00000045552 ; Htr2c-006; intron 2
OTTMUST00000045515 ; Htr2c-001; intron 3
ENSMUST00000112831 ; Htr2c-006; intron 2
ENSMUST00000134368 ; Htr2c-007; intron 2
ENSMUST00000156697 ; Htr2c-003; intron 2
ENSMUST00000036303 ; Htr2c-002; intron 2
ENSMUST00000131999 ; Htr2c-004; intron 2
ENSMUST00000096299 ; Htr2c-001; intron 3
Clustered miRNAs
< 10kb from mmu-mir-764
mmu-mir-3552chrX: 146999405-146999509 [+]
mmu-mir-764chrX: 147002259-147002366 [+]
mmu-mir-1912chrX: 147009441-147009527 [+]
mmu-mir-1264chrX: 147010601-147010686 [+]
Database links

Mature sequence mmu-miR-764-5p

Accession MIMAT0003894
Sequence

27 - 

ggugcucacauguccuccu

 - 45

Get sequence
Deep sequencing44 reads, 12 experiments
Evidence experimental; PCR [1], RAKE [1], Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-764-3p

Accession MIMAT0003895
Sequence

66 - 

aggaggccauaguggcaacugu

 - 87

Get sequence
Deep sequencing482 reads, 19 experiments
Evidence experimental; PCR [1], RAKE [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).