Stem-loop sequence mmu-mir-1298

AccessionMI0004300 (change log)
Symbol MGI:Mir1298
DescriptionMus musculus miR-1298 stem-loop
Gene family MIPF0000598; mir-1298
Literature search

4 open access papers mention mmu-mir-1298
(6 sentences)

Stem-loop
          u         u    c            ------c       cc 
5' gaggggu aagaguuca ucgg uguccagaugua       ccaagua  c
   ||||||| ||||||||| |||| ||||||||||||       |||||||   
3' cucuucg uuuucaagu aguc acgggucuacau       gguuuau  u
          c         u    a            acauaac       ug 
Get sequence
Deep sequencing
17717 reads, 43.6 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by sequencing [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 147064905-147065002 [+]
sense
OTTMUST00000045550 ; Htr2c-004; intron 2
OTTMUST00000045548 ; Htr2c-002; intron 2
OTTMUST00000045549 ; Htr2c-003; intron 2
OTTMUST00000045553 ; Htr2c-007; intron 2
OTTMUST00000045552 ; Htr2c-006; intron 2
OTTMUST00000045515 ; Htr2c-001; intron 3
ENSMUST00000112831 ; Htr2c-006; intron 2
ENSMUST00000134368 ; Htr2c-007; intron 2
ENSMUST00000156697 ; Htr2c-003; intron 2
ENSMUST00000036303 ; Htr2c-002; intron 2
ENSMUST00000131999 ; Htr2c-004; intron 2
ENSMUST00000096299 ; Htr2c-001; intron 3
Database links

Mature sequence mmu-miR-1298-5p

Accession MIMAT0014809
Previous IDsmmu-miR-1298
Sequence

14 - 

uucauucggcuguccagaugua

 - 35

Get sequence
Deep sequencing9936 reads, 38 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-1298-3p

Accession MIMAT0014810
Previous IDsmmu-miR-1298*
Sequence

66 - 

caucugggcaacugauugaacu

 - 87

Get sequence
Deep sequencing7766 reads, 16 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).