Stem-loop sequence mmu-mir-670

AccessionMI0004295 (change log)
Symbol MGI:Mir670
DescriptionMus musculus miR-670 stem-loop
Gene family MIPF0000734; mir-670
Literature search

2 open access papers mention mmu-mir-670
(2 sentences)

Stem-loop
      uu     ug gc      uc        u     - ug     gaac 
5' ggu  ggagg  g  cugaca  ccugagug augug g  aaccu    u
   |||  |||||  |  ||||||  |||||||| ||||| |  |||||    u
3' ucg  ucucc  c  gacugu  ggacuuac uauac c  uuggg    g
      cu     gu --      ga        c     u cu     uccc 
Get sequence
Deep sequencing
707 reads, 0 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 94261300-94261399 [-]
sense
OTTMUST00000034269 ; RP23-201G13.1-002; intron 1
OTTMUST00000034268 ; RP23-201G13.1-001; exon 2
ENSMUST00000129661 ; E530001K10Rik-002; intron 1
ENSMUST00000134563 ; E530001K10Rik-001; exon 2
Database links

Mature sequence mmu-miR-670-5p

Accession MIMAT0003736
Previous IDsmmu-miR-670
Sequence

21 - 

aucccugaguguauguggugaa

 - 42

Get sequence
Deep sequencing300 reads, 36 experiments
Evidence experimental; MPSS [1], RAKE [2], Illumina [3,5]
Database links
Predicted targets

Mature sequence mmu-miR-670-3p

Accession MIMAT0017242
Previous IDsmmu-miR-670*
Sequence

60 - 

uuuccucauauccauucaggagugu

 - 84

Get sequence
Deep sequencing398 reads, 38 experiments
Evidence experimental; 454 [4], Illumina [5]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).