Stem-loop sequence mmu-mir-672

AccessionMI0004258 (change log)
Symbol MGI:Mir672
DescriptionMus musculus miR-672 stem-loop
Gene family MIPF0000391; mir-672
Literature search

12 open access papers mention mmu-mir-672
(46 sentences)

Stem-loop
       g  aucua      u g        u     u           guaua 
5' gaug ug     gcccuu a uuuugagg uggug acuguguguga     c
   |||| ||     |||||| | |||||||| ||||| |||||||||||     a
3' cuac ac     ugggag u aaagcuuc aucac ugacacacacu     u
       -  ----g      - g        u     -           auuua 
Get sequence
Deep sequencing
52968 reads, 132 reads per million, 93 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 104116175-104116274 [-]
sense
OTTMUST00000043694 ; RP23-35L3.1-001; intron 1
OTTMUST00000043695 ; RP23-35L3.1-002; intron 1
ENSMUST00000118314 ; C77370-001; intron 1
ENSMUST00000056502 ; C77370-002; intron 1
ENSMUST00000087879 ; C77370-201; intron 1
Database links

Mature sequence mmu-miR-672-5p

Accession MIMAT0003735
Previous IDsmmu-miR-672
Sequence

25 - 

ugagguugguguacuguguguga

 - 47

Get sequence
Deep sequencing52544 reads, 93 experiments
Evidence experimental; MPSS [1], cloned [2-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-672-3p

Accession MIMAT0017241
Previous IDsmmu-miR-672*
Sequence

63 - 

acacacagucacuaucuucga

 - 83

Get sequence
Deep sequencing421 reads, 40 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).