Stem-loop sequence mmu-mir-802

AccessionMI0004249 (change log)
Symbol MGI:Mir802
DescriptionMus musculus miR-802 stem-loop
Gene family MIPF0000353; mir-802
Literature search

20 open access papers mention mmu-mir-802
(136 sentences)

Stem-loop
   ------  uc      u     auc   a          a   ---      c 
5'       gg  cuauua uugca   agu acaaagauuc ucc   uugugu a
         ||  |||||| |||||   ||| |||||||||| |||   |||||| a
3'       cc  gauaau aaugu   uca uguuucugag agg   aacaua u
   ccacuu  --      u     gac   c          -   cac      c 
Get sequence
Deep sequencing
3302 reads, 15.6 reads per million, 32 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 93369720-93369816 [+]
intergenic
Database links

Mature sequence mmu-miR-802-5p

Accession MIMAT0004188
Previous IDsmmu-miR-802
Sequence

18 - 

ucaguaacaaagauucauccuu

 - 39

Get sequence
Deep sequencing1462 reads, 28 experiments
Evidence experimental; miRAP-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence mmu-miR-802-3p

Accession MIMAT0017240
Previous IDsmmu-miR-802*
Sequence

56 - 

acggagagucuuugucacucag

 - 77

Get sequence
Deep sequencing1840 reads, 23 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).