Stem-loop sequence mmu-mir-3475

AccessionMI0004220 (change log)
Symbol MGI:Mir3475
DescriptionMus musculus miR-3475 stem-loop
Stem-loop
   --          acc  ca       -ucc   u 
5'   caaaucaugu   cc  cagaggg    aga g
     ||||||||||   ||  |||||||    |||  
3'   guuugguaca   gg  gucuucu    ucu g
   aa          --c  ag       ugau   u 
Get sequence
Deep sequencing
1746 reads, 2.08 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown by Illumina sequencing [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 140310948-140311012 [+]
intergenic
Database links

Mature sequence mmu-miR-3475-5p

Accession MIMAT0026642
Sequence

2 - 

aaaucauguacccccacagagg

 - 23

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence mmu-miR-3475-3p

Accession MIMAT0015219
Sequence

45 - 

ucuggaggcacaugguuugaa

 - 65

Get sequence
Deep sequencing1739 reads, 48 experiments
Evidence experimental; Illumina [2-3]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).