Stem-loop sequence mmu-mir-762

AccessionMI0004215 (change log)
Symbol MGI:Mir762
DescriptionMus musculus miR-762 stem-loop
Gene family MIPF0000624; mir-762
Literature search

16 open access papers mention mmu-mir-762
(69 sentences)

Stem-loop
      -   -   cgg          gca      g        
5' gcc cgg cuc   gucucggccc   cggucc gccggcc 
   ||| ||| |||   ||||||||||   |||||| |||||| a
3' cgg gcc gag   cagggccggg   gucggg cggucgu 
      u   c   --a          ---      g        
Get sequence
Deep sequencing
34 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 127708487-127708562 [+]
antisense
OTTMUST00000056115 ; Bcl7c-002; 5'UTR (exon 1)
OTTMUST00000056114 ; Bcl7c-001; 5'UTR (exon 1)
ENSMUST00000106282 ; Bcl7c-002; 5'UTR (exon 1)
ENSMUST00000061468 ; Bcl7c-001; 5'UTR (exon 1)
Database links

Mature sequence mmu-miR-762

Accession MIMAT0003892
Sequence

48 - 

ggggcuggggccgggacagagc

 - 69

Get sequence
Deep sequencing31 reads, 23 experiments
Evidence experimental; Northern [1], RAKE [1]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).