Stem-loop sequence mmu-mir-770

AccessionMI0004203 (change log)
Symbol MGI:Mir770
DescriptionMus musculus miR-770 stem-loop
Gene family MIPF0000355; mir-770
Literature search

7 open access papers mention mmu-mir-770
(104 sentences)

Stem-loop
       ----c        c       a      gucu  g       a    
5' gcca     cuucugug ccccagc ccacgu    gg ccacgug gca 
   ||||     |||||||| ||||||| ||||||    || ||||||| || a
3' cggu     ggggacgc ggggucg ggugca    cc ggugcac cgc 
       agucu        c       a      --gu  g       -    
Get sequence
Deep sequencing
57804 reads, 39 reads per million, 59 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109563692-109563785 [+]
sense
OTTMUST00000055474 ; Meg3-006; intron 4
OTTMUST00000055469 ; Meg3-001; exon 5
OTTMUST00000055471 ; Meg3-003; intron 9
ENSMUST00000143847 ; Meg3-006; intron 4
ENSMUST00000166636 ; Meg3-201; intron 4
ENSMUST00000146701 ; Meg3-001; exon 5
ENSMUST00000143836 ; Meg3-003; intron 9
Clustered miRNAs
< 10kb from mmu-mir-770
mmu-mir-770chr12: 109563692-109563785 [+]
mmu-mir-673chr12: 109571990-109572080 [+]
Database links

Mature sequence mmu-miR-770-5p

Accession MIMAT0004822
Sequence

19 - 

agcaccacgugucugggccacg

 - 40

Get sequence
Deep sequencing4936 reads, 35 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-770-3p

Accession MIMAT0003891
Sequence

53 - 

cgugggccugacguggagcugg

 - 74

Get sequence
Deep sequencing52860 reads, 56 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).