Stem-loop sequence mmu-mir-671

AccessionMI0004133 (change log)
Symbol MGI:Mir671
DescriptionMus musculus miR-671 stem-loop
Gene family MIPF0000358; mir-671
Literature search

20 open access papers mention mmu-mir-671
(64 sentences)

Stem-loop
   u   ----a   ca        a   a      ga           -u   g 
5'  ggc     ggc  ggaagagg gga gcccug  ggggcuggagg  gau g
    |||     |||  |||||||| ||| ||||||  |||||||||||  |||  
3'  ccg     ccg  cuuucucc ccu cgggac  ucuuggccucc  uug a
   a   agaug   ag        a   -      --           uu   u 
Get sequence
Deep sequencing
27012 reads, 56.1 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 24592114-24592211 [+]
sense
OTTMUST00000075599 ; Chpf2-001; 3'UTR (exon 4)
ENSMUST00000121863 ; Chpf2-001; 3'UTR (exon 4)
ENSMUST00000088295 ; Chpf2-201; 3'UTR (exon 4)
antisense
OTTMUST00000075592 ; Smarcd3-002; exon 12
ENSMUST00000144995 ; Smarcd3-002; exon 12
Database links

Mature sequence mmu-miR-671-5p

Accession MIMAT0003731
Previous IDsmmu-miR-671
Sequence

19 - 

aggaagcccuggaggggcuggag

 - 41

Get sequence
Deep sequencing19840 reads, 102 experiments
Evidence experimental; MPSS [1], RAKE [2], cloned [3], Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-671-3p

Accession MIMAT0004821
Sequence

58 - 

uccgguucucagggcuccacc

 - 78

Get sequence
Deep sequencing7128 reads, 99 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).