Stem-loop sequence mmu-mir-551b

AccessionMI0004131 (change log)
Symbol MGI:Mir551b
DescriptionMus musculus miR-551b stem-loop
Gene family MIPF0000360; mir-551
Literature search

6 open access papers mention mmu-mir-551b
(150 sentences)

Stem-loop
       ------     ug   ca          cu     - -aga    gug 
5' gugc      ucuug  gcc  ugaaaucaag  ugggu g    ccug   c
   ||||      |||||  |||  ||||||||||  ||||| |    ||||    
3' uacg      agaac  cgg  acuuugguuc  accca c    ggac   a
       ucagua     gu   ug          au     g ggaa    aag 
Get sequence
Deep sequencing
5953 reads, 78 reads per million, 41 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 29416823-29416920 [+]
sense
OTTMUST00000074399 ; Egfem1-002; intron 4
OTTMUST00000074400 ; Egfem1-003; intron 4
OTTMUST00000074403 ; Egfem1-006; intron 4
OTTMUST00000074398 ; Egfem1-001; intron 5
ENSMUST00000146943 ; Egfem1-006; intron 4
ENSMUST00000126420 ; Egfem1-002; intron 4
ENSMUST00000118531 ; Egfem1-003; intron 4
ENSMUST00000119598 ; Egfem1-001; intron 5
Database links

Mature sequence mmu-miR-551b-5p

Accession MIMAT0017236
Previous IDsmmu-miR-551b*
Sequence

18 - 

gaaaucaagcuugggugagaccu

 - 40

Get sequence
Deep sequencing49 reads, 9 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-551b-3p

Accession MIMAT0003890
Previous IDsmmu-miR-551b
Sequence

57 - 

gcgacccauacuugguuucag

 - 77

Get sequence
Deep sequencing5892 reads, 40 experiments
Evidence experimental; MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).