Stem-loop sequence mmu-mir-1264

AccessionMI0004130 (change log)
Symbol MGI:Mir1264
DescriptionMus musculus miR-1264 stem-loop
Gene family MIPF0000098; mir-95
Literature search

3 open access papers mention mmu-mir-1264
(3 sentences)

Stem-loop
      gg            c     -    u        aaaaaa 
5' ccu  cauauagcaggu cucaa uaag auuuguug      u
   |||  |||||||||||| ||||| |||| ||||||||      a
3' gga  guguauugucca gaguu auuc uaaacaac      a
      -g            c     u    -        gaagua 
Get sequence
Deep sequencing
428 reads, 0 reads per million, 24 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by sequencing [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 147010601-147010686 [+]
sense
OTTMUST00000045550 ; Htr2c-004; intron 2
OTTMUST00000045548 ; Htr2c-002; intron 2
OTTMUST00000045549 ; Htr2c-003; intron 2
OTTMUST00000045553 ; Htr2c-007; intron 2
OTTMUST00000045552 ; Htr2c-006; intron 2
OTTMUST00000045515 ; Htr2c-001; intron 3
ENSMUST00000112831 ; Htr2c-006; intron 2
ENSMUST00000134368 ; Htr2c-007; intron 2
ENSMUST00000156697 ; Htr2c-003; intron 2
ENSMUST00000036303 ; Htr2c-002; intron 2
ENSMUST00000131999 ; Htr2c-004; intron 2
ENSMUST00000096299 ; Htr2c-001; intron 3
Clustered miRNAs
< 10kb from mmu-mir-1264
mmu-mir-764chrX: 147002259-147002366 [+]
mmu-mir-1912chrX: 147009441-147009527 [+]
mmu-mir-1264chrX: 147010601-147010686 [+]
Database links

Mature sequence mmu-miR-1264-5p

Accession MIMAT0014802
Sequence

14 - 

agguccucaauaaguauuuguu

 - 35

Get sequence
Deep sequencing174 reads, 18 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mmu-miR-1264-3p

Accession MIMAT0014803
Sequence

55 - 

caaaucuuauuugagcaccugu

 - 76

Get sequence
Deep sequencing251 reads, 17 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).